1. Virus Genes 17:3, 271±278, 1998
# 1998 Kluwer Academic Publishers, Boston. Manufactured in The Netherlands.
Cloning and Sequence Analysis of Banana Streak Virus DNA
GLYN HARPER & ROGER HULL*
Virus Research Department, John Innes Centre, Norwich Research Park, Colney, Norwich, Norfolk NR4 7UH, UK
Received January 26 1998; Accepted July 3 1998
Abstract. Banana streak virus (BSV), a member of the Badnavirus group of plant viruses, causes severe problems
in banana cultivation, reducing fruit yield and restricting plant breeding and the movement of germplasm. Current
detection methods are relatively insensitive. In order to develop a PCR-based diagnostic method that is both
reliable and sensitive, the genome of a Nigerian isolate of BSV has been sequenced and shown to comprise 7389 bp
and to be organized in a manner characteristic of badnaviruses. Comparison of this sequence with those of other
badnaviruses showed that BSV is a distinct virus. PCR with primers based on sequence data indicated that BSV
sequences are present in the banana genome.
Key words: banana streak badnavirus, virus sequence, virus diagnosis, badnavirus phylogeny
Introduction (RTBV; 4,5), sugarcane bacilliform virus (ScBV; 6),
cocoa swollen shoot virus (CSSV; 7) and are known
Banana (Musa) is the world's fourth most important for at least two other members. This information has
commodity and is a subsistence and cash crop for revealed common features of the group. They all have
many smallhold farmers particularly in West and similar genome organizations with three open reading
Central Africa. Currently, improvements in the frames (ORFs) (except RTBV, which has four)
disease resistance, fruit yield and other agronomic encoded on one strand. The ®rst two ORF's
qualities of bananas and plantains are being investi- potentially encode two small proteins (ORF 1
gated by the International Institute for Tropical $ 22 kD, ORF 2 $ 14 kD) of unknown function.
Agriculture (IITA), Nigeria. These improvements The third ORF ( $ 210 kD) encodes a polyprotein that
have been hampered by the recent diagnosis of is proteolytically cleaved to yield the viral coat
banana streak virus (BSV) (1) in the banana breeding protein which contains a region with homology to an
stocks and quarantine regulations have been pre- RNA binding domain together with regions with
venting the movement of infected plant materials, homology to aspartic protease (AP), reverse tran-
even improved varieties. scriptase (RT) and RNase H (RH). In RTBV the extra
BSV is a member of the badnavirus group (2) ORF, ORF 4, is downstream of ORF 3 and has an
which have non-enveloped bacilliform particles of unknown function. These features, together with a
size 30 Â 130±150 nm, containing a circular double- potential tRNAmet binding site, suggest that badna-
stranded DNA genome of 7.4±8.0 kbp. The full viruses are pararetroviruses.
sequences of the genomes of four members of this Following virus entry into the cell and nucleus the
group have been reported, Commelina yellow mottle genome is transcribed into a greater than genome
virus (CoYMV; 3), rice tungro bacilliform virus length transcript, that ( presumably) is both a
polycistronic mRNA and a replication template. The
*Corresponding author: Professor Roger Hull. DNA negative strand, primed by host tRNAmet is
The nucleotide sequence data reported in this paper has been
submitted to the EMBL nucleotide sequence database and have
synthesized by a virally-encoded reverse transcrip-
been assigned the accession number AJ002234. E-mail addresses: tase, and the positive strand by the same enzyme and
glyn.harper@bbsrc.ac.uk and roger.hull@bbsrc.ac.uk the virally encoded RH.

2. 272 Harper and Hull
The use of RT in their replication can potentially quarantined for 1 month, prior to moving to the
lead to high degree of variation between isolates and greenhouse and maintenance at 28 C day, 25 C night.
different group members, and such variation has Leaf material was ®nely ground in liquid nitrogen
already been reported for BSV (8). and blended into 2 volumes buffer A [50 mM sodium
BSV is becoming of major importance for two phosphate pH 6.1, 5 mM dithiothreitol, 5 mM diethyl-
reasons; it is increasingly being recognized as causing dithiocarbamate, 0.5% polyethylene glycol (PEG
disease world-wide, especially in subsistance bananas 6000)]. Celluclast (Novo Nordisk) was added to 2%,
and plantains; there is accumulating evidence for BSV incubated with stirring at 37 C for 2 h then overnight
sequences being integrated into the Musa genome at room temperature. Triton X-100 was added to 1%
causing problems not only in the safe movement of and the incubation carried out for a further 30 min. All
germplasm, but also in breeding and tissue culture. subsequent steps were carried out at 4 C. The
This highlights the need for the determination of supernatant from a low speed centrifugation at
speci®c properties of BSV that could be used for its 10,000 g for 10 min, was further centrifuged at
diagnosis. The symptoms of BSV can be confused 120,000 g for 90 min. The pellet was resuspended in
with those of cucumber mosaic virus (CMV). BSV is 100 ml buffer A, centrifuged through a 5% sucrose
serologically heterogeneous (8) and is present at low cushion at 120,000 g for 2.5 h and the pellet
titre in the host. Serological methods in use, resuspended in 5 ml buffer A. The virus was further
particularly ISEM, require sophisticated equipment puri®ed according to Lockhart (2) by centrifugation in
and are relatively insensitive. Here we report on the a 0±40% Cs2SO4 gradient in 10% sucrose [steps 40,
sequence of a Nigerian isolate of the virus which 30, 20, 10, 0%] at 120,000 g for 2.5 h. The viral band
could be of use in PCR-based diagnostic systems. was identi®ed by ISEM, carried out according to
To date there is little evidence of plant viral Lockhart (2) using mixed BSV antisera (kindly
sequences integrated into host plants, and none for an supplied by Dr. B.E.L. Lockhart). The virus was
integrant that could result in excision or the diluted four fold in buffer A, pelleted at 150,000 g for
production of functional transcripts to give episomal 60 min and resuspended in 100 ml 50 mM sodium
virus infection. Portions of a geminivirus are reported phosphate pH 6.1.
to be integrated into the tobacco genome (9). Petunia
vein-clearing virus (PVCV), a plant pararetrovirus, Cloning and Sequence Analysis
has been shown to carry typical consensus sequence
elements of the integrase proteins of retroviruses and Virion DNA was puri®ed by digestion of virus
LTR retrotransposons. Preliminary evidence suggests particles with Proteinase K at 1 mg/ml in 100 mM
PVCV to be a covalent component of cellular DNA of TrisCl pH 8.0, 2 mM CaCl2, 2% SDS, for 2 h at 65 C.
Petunia sp. (10). La Fleur et al. (11) suggested the Following phenol extraction, the DNA was precipi-
possible integration of portions of the BSV genome tated, washed in 70% ethanol, dried and resuspended
into Musa, and we have obtained similar evidence. in 50 ml TE [10 mM TrisCl, 1 mM EDTA pH 8.0)
The nature of the potentially active integrated virus (12)]. The DNA was digested with EcoR1 and the
will have to be compared with the episomal form and resulting fragments cloned into pBluescript II SK ‡
these data are presented here. (Stratagene). One clone had sequence homology to
ScBV and other badnaviruses. Primers were designed
using the clone sequence information to allow
Materials and Methods PCR ampli®cation of the entire virion DNA.
The primers were contiguous, facing in opposite
Virus Isolation and Puri®cation directions (nucleotide numbering for the com-
pleted BSV sequence, see below): V1514 5H
BSV-infected banana plants (cultivar TMPx 4698, a TGCGGGTGCTTCTTCACCC (anti-sense @ 2778),
tetraploid hybrid of Obino l''Ewai  Calcutta 4) were V1517 5H TATGCACCAGCTACAAGTGC (sense @
supplied, as in vitro plantlets or screenhouse-grown 2779). The ExpandTM Long Template PCR system
plant suckers, by IITA, Onne Field Station, Nigeria. (Boehringer) was used, following the manufacturer's
Plant sucker outer tissue was removed and the corms protocol for a 0.5±12 kb template (system 1). The
were sterilized in 1% sodium hypochlorite for 1 h and template was 0.1±1.0 ml of the isolated virus DNA and

3. Banana Streak Badnavirus Sequence 273
the primers were used at a ®nal concentration of separated by electrophoresis through a 1.5% agarose
300 nM. The ampli®cation cycle conditions were gel and detected by ¯uorescence of ethidium bromide
94 C Â 1 min, [92 C Â 20 s, 50 C Â 30 s, 68 C Â under UV light. Following photography, the reaction
6 min] Â 10, [92 C Â 20 s, 50 C Â 30 s, 68 C Â products were transferred onto nylon membrane
6 min with 20 s increment/cycle] Â 15 and a ®nal (Hybond-N, Amersham). A 32P-labeled probe was
extension for 68 C Â 7 min. synthesized by random priming using the full-length
The 7.39 kb PCR product and sub-clones derived BSV PCR product as template (15). Hybridization and
from it were sequenced manually using Sequenase washing was at 65 C using the solutions and protocols
version 2.0 (USB, United States Biochemicals) and described by the membrane supplier (Amersham).
automatically using the Prism system (Applied
Biosystems) and an ABI 373 sequencer. The sequence
was analyzed using the GCG sequence package (13).
Results
All DNA manipulations were performed according to
Sambrook et al. (12).
Virus Puri®cation
For isolation of RNA, 2 g symptomatic banana
leaves were ground to a powder in liquid N2, added to
The virus puri®cation gave a low yield of bacilliform
24 ml 100 mM Tris-Cl pH 8.0, 20 mM EDTA, 500 mM
particles of size $ 30 Â 130 nm, that could be trapped
NaCl, 20 mM mercaptoethanol, 2% SDS and incu-
on BSV antiserum-coated carbon grids but not on
bated at 65 C for 10 min. After the addition of 8 ml
CSSV antiserum-coated grids. The virus could be
3M sodium acetate and incubation on ice for 10 min,
detected by ISEM in a crude extract of infected leaf,
the solution was centrifuged at 10,000 Â g for 10 min
but not in leaf-dip preparations.
and the supernatant was ®ltered through two layers of
Miracloth. The nucleic acid was precipitated by the
addition of 0.7 vol. isopropanol, incubation at À 20 C Virus Sequence Analysis
for 30 min and centrifugation. The pellet was
resuspended in 2 ml TE, extracted with phenol/ The complete 7389 bp nucleotide sequence of both
chloroform then chloroform and the RNA precipitated strands of the Nigerian isolate of BSV was determined
by the addition of lithium acetate to give 2 M and (accession AJ002234 in EMBL database). As with
incubation at 4 C overnight. The RNA pellet was other badnaviruses and caulimoviruses the numbering
washed twice in 80% ethanol and resuspended in 40 ml of the sequence begins at the putative 5H minus-strand
met
water. Formaldehyde-containing agarose gel electro- priming site and this conserved tRNAinit binding site
phoresis and northern blotting of RNA was as sequence is found in BSV.
described in Sambrook et al. (12). The 5H end of the Overall the sequence shows low but recognizable
transcript was mapped by primer extension using the similarity to other badnaviruses, with highest simi-
method of Medberry et al. (3). The primer used was larity to ScBV and least to RTBV (Table 1)
5H - ATCTTGCGCTCTACTCGC at 7361 bp in the (Dioscorea alata bacilliform virus (DaBV) sequence
BSV sequence. was kindly provided by R. Briddon). A phylogenetic
Primer Design and PCR Table 1. Comparison of BSV sequence with those of other
badnaviruses
PCR primer pairs were chosen from aligned amino BSV
acid sequences corresponding to the aspartic protease Amino Acid Similarities%
and reverse transcriptase regions of the derived BSV Nucleotide
Similarity% ORF 1 ORF 2 ORF 3
sequences. The PCR was performed on DNA isolated
from banana leaves using the method of Li et al. (14), CoYMV 43.4 63.7/48.2a 52.6/28.5 66.1/45.8
using the basic protocol described by manufacturers CSSV 48.8 56.3/32.6 48.3/24.6 64.4/44.5
of the Taq DNA polymerase (Gibco BRL). The DaBV 47.8 55.4/31.6 44.6/20.6 65.5/46.1
ScBV 51.6 57.1/41.1 45.2/25.0 63.9/45.3
conditions were 94 C for 2 min, [94 C for 1 min, 40±
RTBV 39.6 52.0/21.0 36.9/18.9 50.6/30.5
50 C for 1 min, 72 C for 1 min] Â 30 cycles, followed
by a 5 min extension at 72 C. Reaction products were a
familial identity/direct identity

4. 274 Harper and Hull
analysis of the relationship of BSV to other
badnaviruses is shown in Fig. 1. The close relation-
ship to SCBV con®rms the serological relationship
noted by Lockhart (1). The sequence is suf®ciently
different from those of other badnaviruses for BSV to
be considered a distinct virus.
The + strand contains three large ORF's (Fig. 2).
This number, their size and order are similar to other
badnavirus sequences, with the exception of RTBV
which possesses an additional ORF (4,5). At the
amino acid level BSV shows most similarity to
CoYMV and least to RTBV (Table 1). BSV ORF 3 is
more similar to those of other badnaviruses than is
ORF 1 which, in turn, is more similar than ORF 2. The
similarity in ORF 3 is particularly notable over
regions that encode the putative viral replicase
functions AP, RT and RH and shows the conservation
of critical residues in three functions in this
Fig. 2. Organization of the BSV genome. The complete circle
polyprotein (Fig. 3). The majority of differences are represents the double-stranded DNA genome. The inner circle
between RTBV and the other badnaviruses. Other shows the mapping of the RNA transcript with the position of the
sequence elements identi®ed in other plant parare- 3H end being estimated. The outer arcs indicate the positions of
troviruses including the as-1 sequence motif have also the three open reading frames (ORFs). The location of the 675 bp
been detected in BSV (Fig. 4). cloned viral fragment is indicated by the shaded arc and its
position corresponds to BSV 2663±3338.
Transcript Mapping
The proportion of viral RNA in RNA isolated from
infected leaves is very small and for this reason the
analysis of RNA gives weak results. Different
methods of isolation give similar results. Northern
blots of total RNA from BSV-infected banana tissue
revealed only one BSV-speci®c band of approxi-
mately 7.5 kb (Fig. 5a). This is the size expected for
the major transcript of a pararetrovirus the size of
BSV.
To map the 5H end of the major transcript, RNA
extracted from infected banana tissue was used for
primer extension. The primer was designed to be near
the position expected from other badnaviruses to be
the start of a full-length transcript. Two strong stops
were found (Fig. 5b) indicating that the transcript start
Fig. 1. Phylogenetic analysis of badnavirus sequences. Phylogeny site was at 7260 or 7261 bp, 25 nt downstream of a
was inferred from the complete DNA genomes of the indicated potential TATA box (TATATAA) sequence (see later).
viruses using the maximum likelihood method DNAML 4 of the
Phylip suite of program (J. Felsenstein. Dept of Genetics,
Attempts to map the 3H end of the transcript using
University of Washington, unpublished). The sequences used are the approach of Medberry et al. (3) proved
described in the text. unsuccessful.

5. Banana Streak Badnavirus Sequence 275
Fig. 3. Comparison of conserved amino acid sequences in ORF 3 of BSV and other badnaviruses. * ˆ Familial similarity.
Fig. 4. Sequence comparison of promoter elementsa. The sequence and relative positions of as-1 and TATA sequences in members of two
groups of plant pararetroviruses. a Adapted from Medberry et al. (23). * CoYMV as-1 sequence is from 7149±7127.
PCR Detection of BSV probe and sequencing of this product con®rmed its
origin as BSV. Ampli®cation of this band could also
Primer sequences for PCR were selected from within be achieved from crude preparations from infected
the conserved sequences putatively coding for RT and plants. All Musa plants tested gave this same size
AP. This primer pair consistently gave a strong band, and all plants from Onne station gave the same
ampli®cation product of the expected size of 644 bp pattern when the band was cut with Alu 1 (data not
with Musa DNA (Fig. 6). Hybridisation with a BSV shown).

6. 276 Harper and Hull
Fig. 6. PCR ampli®cation of BSV sequences from DNA isolated
from banana cultivars. 1. Control BSV DNA; 2. Field accession
Fig. 5a. Northern analysis of BSV RNA. RNA isolated from 115-bc; 3. Cuban accession; 4. TMPx 5511/2; 5.TMPx 4698/1; 6.
leaves of BSV infected Musa was separated by formaldehyde- Dwarf Cavendish; 7. Field accession T-3-1a using primers based
containing agarose gel electrophoresis. Following blotting the on the conserved sequences putatively encoding BSV RT and AP.
membrane was probed with radio-labeled BSV DNA and the Track M is 1 kbp marker ladder. The size of the PCR product is
hybridizing band is arrowed. Marked bp sizes are Promega RNA 644 bp.
markers.
Discussion
The sequence of the Nigerian isolate of BSV con®rms
that this is a badnavirus as it has a similar genome
organization to other badnaviruses. The BSV genome
contains three large ORF's (Fig. 2) potentially coding
for proteins of 20.8, 14.5 and 208 kD. The size and
order of the ORF's are very similar to those of most
other badnaviruses. Characteristically the ORF's
overlap, that between ORFs 1 and 2 being ATGA
(ATG being start of ORF 2 and TGA stop of ORF 1)
and thus resembling RTBV (4) and that between
ORFs 2 and 3 being TAATG. Badnaviruses are
characterised by having very few AUG translational
start codons in the ®rst two ORFs (see reference 16).
È
Futterer et al. (16) proposed that ORFs 2 and 3 of
RTBV (and other badnaviruses) are translated by
leaky scanning due to the paucity or poor context of
start codons in ORFs 1 and 2. It was also suggested
Fig. 5b. Characterization of the BSV transcript by primer that the AUG-rich leader sequence is bypassed, at
extension. The reaction products to the extension of a primer (5H least in RTBV, by a ``ribosome-shunt'' mechanism
end at nucleotide 7361) on BSV RNA are in lane PE; the two
transcript termination bands are identi®ed by arrows The
(17). The leader sequence of BSV is rich in AUG
sequencing reactions using the same primer are in lanes A, C, G, codons. ORF 1 has four AUG codons which is more
T which are the included dideoxynucleotide. than other badnaviruses but they are all in poor

7. Banana Streak Badnavirus Sequence 277
context (18); the sole AUG codon in ORF 2, that at the virus 20 nt; (26)]. Although it was not possible to map
start, is also in a poor context. Thus, although there are the 3H end of the BSV transcript it can not be
more AUG codons than other badnaviruses in ORF 1 downstream of the tRNA binding site as this would
it is likely that the expression strategy is similar to that affect the replication mechanism. The 5H end of the
È
described by Futterer et al. (16). transcript is 128/127 nt from the tRNA binding site
The presence and arrangement of functional but no polyadenylation signal motifs were found
domains in ORF 3, cysteine rich zinc ®nger-like downstream of that at 7295.
RNA-binding domain common to all retroelements Using the sequence information, a potential
(19), AP, RT and RH found in ORF 3 are identical to diagnostic PCR assay has been developed that
the those found in other badnaviruses (Fig. 4). This allows highly sensitive and speci®c detection of
ORF also contains the additional cysteine-motif BSV in Nigerian banana plants. However, all Musa
characteristic of all other badnaviruses thus far plants tested so far, whether displaying symptoms or
sequenced. The function of this extra ``cys'' sequence not, give positive results with this assay. For example
is unknown but it may be involved with translational in Fig. 6 two of the six plants were not showing typical
control (20). BSV symptoms at the time of sampling. Symptomatic
Phylogenetic analysis of the currently available and serological examination of plants gave an
badnavirus sequences shows BSV to be more closely apparent infection rate of around 30%. The apparently
related to ScBV and the other ``three ORF'' high degree of infection of Musa by BSV shown in
badnavirus than to RTBV. However, at the amino this study, is also echoed by the widespread infection
acid level, BSV is more similar to CoYMV than to of sugarcane by ScBV (27). One strong possibility is
other badnaviruses. As previously noted RTBV is the that viral sequences are integrated into the host
most divergent badnavirus (20): it has four ORF's and genome and genomic Southern analysis does show
is transmitted only with rice tungro spherical virus hybridisation of a BSV probe to high molecular
(RTSV) by a leafhopper vector. In contrast, all other weight Musa DNA. If this is the case, a detection
badnaviruses described so far including BSV have method for episomal BSV will have to be serologi-
three ORF's and are transmitted by a mealybug cally based but could include PCR by using immune-
vector. We only detect a single BSV transcript by capture PCR. This would increase the sensitivity over
Northern analysis in contrast to RTBV (4). normal serological techniques.
The 5H end of the transcript was mapped to the There are very few examples of plant viral
cytosine/adenosine doublet at 7260/7261, a similar sequences integrating into the host sequence with
result and relative position in the genome as in that of a geminivirus thought to be random (9) but that
CoYMV (3) and at ‡ 25 nt with respect to a potential of petunia vein-clearing caulimovirus (PVCV) being
TATA box. In RTBV the transcription start site is also suggested to be potentiated by a virus-encoded
detected as a doublet (20). There is an as-1 like integrase (10). Unlike PVCV, no obvious integrase
sequence as described in CaMV (21,22) and in motif could be found in the BSV sequence.
CoYMV (23). In CaMV the as-1 element is in part In the present study, the virus isolated from
responsible for promoter activity in the root and acts Nigerian plants appeared to have low variability as
as non-speci®c enhancer for other cis elements in judged by restriction length polymorphism analysis
CaMV (21). There is a difference in the spacing (data not shown) in contrast to the serological
pattern from the as-1 element to the TATA box variation of other isolates observed in other studies
between the caulimovirus sequences (22±34 bp) and (8). This may be an indication of the inheritance of the
badnavirus sequences (176±181 bp). In BSV a same BSV sequences in the breeding stocks from
potential polyadenylation signal (AAATAAAAA) is which the material in this study was drawn.
found at 7295 bp. which would give a 35 nt terminal
redundancy to the full-length transcript. This terminal
redundancy is smaller than those of other plant Acknowledgments
pararetroviruses [e.g. CoYMV 109±132 nt, RTBV
215±216 nt; CaMV 176 nt; (3,24,25)] but of similar This work was funded by The Gatsby Foundation as a
size to some of the retrovirus terminal redundancies collaborative project with IITA Nigeria. We thank Sue
[mouse mammary tumor virus, 15 nt; avian leukosis Phillips and Dr A Brunt (Horticulture Research

8. 278 Harper and Hull
International) for invaluable assistance with electron A Laboratory Manual. Cold Spring Harbor Laboratory Press,
microscopy and Mr Mike Harvey for oligonucleotide New York. 1989.
13. Devereux J., Haeberli P., and Smithies O., Nucl Acid Res 12,
synthesis. BSV is held under MAFF Plant Health 387±395, 1984.
licence No. PHL11/2044(8/96). 14. Li Q.B., Cai Q., and Guy C.L., Pl Molec Biol Rep 12, 215±220,
1994.
15. Feinberg A.P. and Vogelstein B., Anal Biochem 132, 6±13,
1983.
References 16. È
Futterer J., Rothnie H.M., Hohn T., and Potrykus I., J Virol 71,
7984±7989, 1997.
1. Lockhart B.E.L., Phytopathology 76, 995±999, 1986. 17. È
Futterer J., Potrykus I., Bao Y., Li L., Burns M., Hull R., and
2. Lockhart B.E.L., Phytopathology 80, 127±131, 1990. Hohn T., J Virol 70, 2999±3010, 1996.
3. Medberry S.L., Lockhart B.E.L., and Olszewski N.E., Nucl 18. Lutche H.A., Chow K.C., Mickel F.S., Moss K.A., Kern H.F.,
Acid Res 18, 5505±5513, 1990. and Scheele G.A., EMBO J 6, 43±48, 1987.
4. Hay J.M., Jones M.C., Blakeborough M.L., Dasgupta I., Davis 19. Covey S.N., Nucl Acids Res 14, 623±633, 1986.
J.W., and Hull R., Nucl Acids Res 19, 2615±2621, 1991. 20. Hull R., Ann Rev Phytopathol 34, 275±297, 1996.
5. Qu R., Bhattacharyya M., Laco G.S., de Kochko A., Subba Rao 21. Lam E., Benfey P.N., Gilmartin P.M., Fang R.-X., and Chua
B.L., Kaniewska M.B., Elmer J.S., Rochester D.E., Smith C.E., N.H., Proc Natl Acad Sci USA 86:, 7890±7894, 1989.
and Beachy R.N., Virology 185, 354±364, 1991. 22. Lam E. and Chua N.-H., Plant Cell 1, 147±1156, 1989.
6. Bouhida M., Lockhart B.E.L., and Olszewski N.E., J Gen Virol 23. Medberry S.L., Lockhart B.E.L., and Olszewski N.E., Plant
74, 15±22, 1993. Cell 4, 185±192, 1992.
7. Hagen L.S., Jacquemond M., Lepingle A., Lot H., and Tepfer 24. Bao Y. and Hull R., Virology 197, 445±448, 1993.
M., Virology 196, 619±628, 1993. 25. Á
Guilley H., Dudley R.K., Jonard G., Balas E., and Richards
8. Lockhart B.E.L. and Olszewski N.E., In: Breeding Banana and K.E., Cell 30, 763±773, 1983.
Plantain for Resistance to Diseases and Pests. J Ganry (ed.). 26. Cof®n J.M., Essex M., Gallo R., Graf T.M., Hinuma Y., Hunter
CIRAD/INIBAP, Montpellier, France, pp 105±113, 1993. E., Jaenisch R., Nusse R., Oroszlan S., Svoboda J., Teich N.,
9. Bejarano E.R., Khashoggi A., Witty M., and Lichtenstein C., Toyoshima K., and Varmus H., In Virus Taxonomy:
Proc Natl Acad Sci 93, 759±764, 1996. Classi®cation and nomenclature of viruses. (eds.) Murphy
È
10. Richert-Poggeler K.R. and Shepherd R.J., Virology 236, 137± F.A., Fauquet C.M., Bishop D.H.L., Ghabrial S.A., Jarvis A.W.,
146, 1997. Martelli G.P., Mayo M.A., and Summers M.D. pp. 193±204,
11. LaFleur D.A., Lockhart B.E.L., and Olszewski N.E., Springer Verlag, 1995.
Phytopathology 86, S100±S101, 1996. 27. Comstock J.C. and Lockhart B.E.L., Plant Disease 74, 530,
12. Sambrook J., Fritsch E.F., and Maniatis T., Molecular Cloning: 1990.